مهندس اشرف جابر فتح الله
اهلابكم فى منتداى مهندس اشرف جابر نرجو التسجيل وقضاء امتع الاوقات


مهندس اشرف جابر فتح الله منتدى تعليمى ترفيهى ومنوعات
 
الرئيسيةالبوابةاليوميةمكتبة الصورس .و .جبحـثالأعضاءالمجموعاتالتسجيلدخول

شاطر | 
 

  مراجعة اسئلة مادة الاحياء , التوقعات المرئية 2012

اذهب الى الأسفل 
كاتب الموضوعرسالة
اشرف جابر فتح الله
مشرف


المساهمات : 4559
تاريخ التسجيل : 07/02/2012
العمر : 50

مُساهمةموضوع: مراجعة اسئلة مادة الاحياء , التوقعات المرئية 2012    الثلاثاء أبريل 09, 2013 10:12 am

نقدم لكم مراجعة اسئلة مادة الاحياء للصف الثالث الثانوي المرحلة الاولى والثانية حيث من المنتظر ان يمتحن الطلاب المادة فى الايام الاخيرة من امتحاناتهم ونقدم لكم ان شاء الله مراجعة قوية لمادة الاحياء من خلال نخبة قوية من المعلمين وتكون المراجعة بالفيديو او بكتابة اهم الاسئلة ونقوم بوضع الاسئلة تباعا لحظة بلحظة ان شاء الله من خلال وضع اسئلة مادة الاحياء ونتمنى ان تنال الاسئلة اعجابكم

بسم الله الرحمن الرحيم

{ مركز كليات القمه }

** بعض الاسئله الرخمه فى ماده الاحياء **

==================

جزىء الكلوروفيل معقد التركيب ؟

لان تركيبه : C55H72O5N4Mg

ما مدى ملائمه الشكل الخارجى لورقه النبات لوظيفتها ؟

نصلها دقيق ومفلطح لاستقبال اكبر قدر من الضوء / بها عروق وعريقات لامتصاص الماء والاملاح / تنتشر بها الثغور خاصه البشره السقلى لتتحكم فى درجه التبخر /

تتحكم الورقه فى كميه التبخر ؟

لان بها الثغور التى تفتح غالبا فى الضوء وتغلق فى الظلام وتتأثر بدرجه الرطوبه

النباتات البدائيه كالطحالب ليس لها جهاز نقل متخصص ؟

لان المواد الازمه للبناء الضوئى والغازات تنتقل خلالها بالانتشار والنقل النشط

الحيوانات الاوليه كالبروتوزوا والهيدرا لا تحتاج جهاز نقل متخصص ؟

لان المواد الغذائيه والغازات تنتقل خلالها بالانتشار

كم مره تمر كريات الدم الحمراء خلال الدوره الدمويه طيله حياتها ؟

172 الف مره

قدره كريات الدم البيضاء على التغلغل بين الشعيرات الدمويه ؟

لانها لا تمتلك شكلا خاصا وتنساب بلا انقطاع لتهاجم الميكروبات وتبتلع الاجسام الغريبه

ماذا يسمع الطبيب بسماعته عند قياس الضغط ؟

- عند بدايه سماع صوت ضربات القلب …….. يكون الضغط الانقباضى / مثلا120 مم زئبق

- عند اختفاء صوت ضربات القلب ………….. يكون عند الضعط الانبساطى / مثلا80 مم زئبق

يدخل حمض البيروفيك الميتوكوندريا ؟

عند توافر الاكسجين ….. لان الطاقه الناتجه من انشطار الجلوكوز لا تكفى للعمليات الحيويه

ما طرق دخول الاكسجين الى النبات ؟

مذاب فى ماء التربه / عن طريق الثغور / عن طريق العديسات او التشققات فى القلف

ما طرق تخلص النبات من ثانى اكسيد الكربون ؟

الاجزاء السطحيه بالانتشار / الاجزاء العميقه تمرره لانسجه الخشب واللحاء ثم الثغور / يستخدم جزء منه فى البناء الضوئى

اكتب نبذه عن التخمر الحامضى ؟

بعض انواع البكتريا عندما تتنفس لا هوائيا تنتج حمض بدلا من الكحول الايثيلى / ويستخدم صناعيا فى منتجات الالبان كالجبن والزبادى

يستمر اخراج العرق فى الشتاء ؟

لان الدم مازال يجرى فى شبكه الشعيرات الدمويه المحيطه بالغدد العرقيه فتستخلص منه العرق / ولان العرق له وظيفه اخراجيه بخلاف خفض درجه حراره الجسم حيث يخرج الماء والاملاح الذائده

تجمع الفضلات فى النبات بطىء جدا ؟

لأن معدل الهدم فى النبات أقل كثيرا عن الحيوان اذا تساوا فى الوزن

يحتاج النبات للماء بمقادير تفوق الحيوان بكثير ؟

لان الحيوان يحتفظ بمعظم الماء فى جسمه ويعيد دورته فيه / اما النبات يخرج 90 % من هذا الماء على هيئه نتح ( اكتب اهميه النتح )

الاحساس ضرورى للتكيف مع البيئه ؟

الاحساس عمليه مركبه تبدأ بالتنبه للمؤثر( خارجى أو داخلى ) ثم ادراك المؤثر ثم الاستجابه المناسبه له

أمثله :

- المؤثر الخارجى : ابعاد الرأس عن صوت مزعج / اغماض العين لضوء ساطع / ارتعاش البدن لتوليد حراره تبعث الدفء عند الصقيع حتى لا يتجمد البروتوبلازم

- المؤثر الداخلى : تناول الطعام او الشراب عند الجوع او العطش

الاحساس ضرورى للارتباط والتنسيق بين الاعضاء ؟

يحدث الارتباط والتنسيق بين وظائف اعضاء الجسم المختلفه عن طريق شبكه الاعصاب المنتشره فى الجسم

مثال : عند بذل مجهود عضلى …… يتوارد الدم بكثره للعضلات محمل بالاكسجين ……… لانتاج الطاقه اللازمه ……… يزيد عدد مرات التنفس ودقات القلب لادخال الاكسجين وخروج اco2 …… تنشط الكليتان والغدد العرقيه لاخراج فضلات الاحتراق

النخاع الشوكى هو المسئول عن الافعال المنعكسه وليس المخ ؟

لان النخاع الشوكى به الماده الرماديه التى تحتوى على ألاف الاقواس الانعكاسيه / فتكون الاستجابه سريعه جدا ثم يعلم المخ بها بعد ثوانى

قارن بين التآزر العصبى والتآزر الهرمونى ؟

العصبى : تحدث الاستجابه للمؤثرات عن طريق سيالات عصبيه ( موجات كهروكيميائيه )

لذلك / فهى اسرع / لكنها تستمر فتره بسيطه

الهرمونى : تحدث الاستجابه عن طريق الهرمونات التى تفرز فى الدم ثم تصل لاهدافها فى الاعضاء

لذلك / فهى اقل سرعه / لكن تأثيرها يستمر فتره اكثر

اذكر امثله للتآزر العصبى الهرمونى ؟

1. عند الخوف مثلا …… يقوم الجهاز السمبثاوى بالتأثير على نخاع الغده الكظريه لافراز الادرينالين ……….. فيزيد النبض والضغط وجلوكوز الدم

2. عند شم رائحه الطعام …….. تقوم المستقبلات الحسيه فى الانف بارسال رساله عصبيه للمخ ومنه الى …………. المعده لتفرز الجاسترين ……… ليحفز المعده لافراز العصاره الهاضمه

قد يصاب مريض السكر بغيبوبه أحيانا ؟

اما لزياده نسبه السكر فى الدم زياده عاليه جدا / واما نقص شديد فى سكر الدم مثل تناول المريض لجرعه الانسولين وعدم تناول الطعام

مم تتركب الهرمونات ؟

من بروتينات معقده / او احماض امينيه بسيطه / او دهون ( ستيرويدات )

علل / تنشأ حركه الكائن الحى ذاتيا ؟

لانها تنشأ نتيجه لاثارته فيستجيب لها سلبا او ايجابا

علل / العضلات هى المسئوله بصفه اساسيه عن الحركه ؟

لان لها القدره على الانقباض والانبساط

وظيفه التكاثر أقل اهميه من الوظائف الاخرى ؟

- لان الوظائف الاخرى لا يستطيع الانسان العيش بدونها فهى تؤمن استمرار الافراد على قيد الحياه

- اما التكاثر فهو يؤمن فقط استمرار الانواع والمحافظه عليها من الانقراض

تختلف قدرات الكائنات الحيه على التكاثر تبعا لظروف البيئه ؟

لان الاحياء المائيه والطفيليات والبدائيات تنتج نسلا كبيرا لكثره تعرضها للهلاك

كثره بعض الكائنات وقله الاخرى ؟

تبعا لنجاح اسلافها فى التكاثر والتأقلم مع البيئه ( وتبعا لنوع التكاثر )

ما طرق التكاثر فى الاسبيروجيرا ؟

فى الظروف الطبيعيه : يتكاثر لا جنسيا بالانقسام الميتوزى

فى الظروف الغيرمناسبه : يتكاثر جنسيا بالاقتران السلمى او الجانبى

أين يحدث تكوين الامشاج واين يحدث تكوين اللاقحه فى بلازموديوم الملاريا ؟

تكوين الامشاج : فى دم لانسان / تكوين اللاقحه : فى معده العوضه

بويضات الانسان شحيحه المح ؟

لان الانسان ينتمى لطائفه الثدييات التى تتميز بحمل الجنين حتى الولاده

ما موضع الجهاز التناسلى لانثى الانسان ؟

فى الحوض / خلف المثانه البوليه / يتثبت باربطه مرنه فى الحوض ليسمح بالتمدد عند الحمل

يوجد ثنيات فى المهبل ؟

لتسمح بتمدده عند الولاده

تتغير حاله الجهاز التناسلى للانثى بصفه دوريه عند البلوغ ؟

تبعا لنشاط المبيضين والرحم وما يرتبط بهم من اخصاب وحمل / أو حدوث الدوره الشهريه

لا يدخل البويضه سوى حيوان منوى واحد بعد الاخصاب ؟

لانها تحيط نفسها بغلاف يمنع دخول اى حيوان منوى اخر بعد الاخصاب

كيف تمكن العلماء من اثبات صحه نظريه الجينات المتكامله ؟

عن طريق خلط مستخلصين من سلالتين لبسله الزهور البيضاء فظهر اللون البنفسجى …. أكمل الاجابه

حالات الهيموفليا وعمى الالوان لا تكون بنفس الشده على كل المرضى ؟

بسبب تداخل فعل جينات مختلفه تقع على مواضع مختلفه على الكروموسوم x

ما علاقه انيميا الخلايا المنجليه بالبيولوجيا الجزيئيه ؟

لانها عباره عن طفره فيحدث تغير فى نوع الاحماض الامينيه المكونه للهيموجلوبين بسبب تغير فى ترتيب القواعد النيتروجينه فيحدث تقوس لكريات الدم الحمراء ……… أكمل الاجابه

ما المقصود بالبوليمرات ؟

هى مركبات طويله تتكون من وحدات بنائيه متكرره / مثل البروتينات والاحماض النوويه

مم يتكون الكروماتين ؟

هو جزىء dna يلتف عده مرات حول البروتين / ويحتوى عاده على كميه متساويه من البروتين و dna

استطاع العلماء دراسه تأثير الاحماض الامينيه على وظائف البروتين ؟

عن طريق تغيير الشفره باستبدال حمض امينى بأخر ودراسه تأثير ذلك على البروتين الناتج

مع تمنياتى لكم بالدرجه النهائيه

الاستاذ الدكتور / هشـــام هيبه / ت : 0129797296

امتحان شامــل – أحيـــاء اجب عن خمسه أسئله فقط الزمــن : 3 ساعــات

———————————————————————————–

السؤال الأول ملحوظه : هذا الامتحان فى أربع صفحات

أ ) اختر الاجابه الصحيحه ثم انقلها فقط فى ورقه اجابتك :

من المغذيات الصغرى للنبات عنصر ……….

أ- الكبريت ب- الكربون جـ- الكلور د- الكالسيوم

أول حمض أمينى فى سلسله عديد الببتيد المتكونه عند تخليق البروتين ……….

أ- الميثيونين ب- الأرجينين جـ- الجلايسين د- الليسين

فصيله الدم AB تتمثل فيها حاله وراثيه تسمى ……….

أ- سياده تامه ب- انعدام سياده جـ- سياده غير تامه د- ارتباط تام

من الكائنات الحيه التى تتكاثر تكاثرا جنسيا ……….

أ- دوده البلاناريا ب- فطر الخميره جـ- فطر عفن الخبز د- طحلب الاسبيروجيرا

من بروتينات بلازما الدم والتى لها علاقه بعمليه تجلط الدم ……….

أ- الالبيومين ب- الجلوبيولين جـ- الفبرينوجين د- كل ما سبق

توجد مراكز الذاكره والنطق فى قشره المخ فى الفص ……….

أ- الجبهى ب- الجدارى جـ- الصدغى د- القفوى



ب ) 1. وضح بالرسم فقط والبيانات :

أطوار بلازموديوم الملاريا التى تشاهدها فى عينه لدم المريض

2. أكتب موضع ووظيفه كل مما يأتى :

أ‌- التجويف الأروح

ب‌- الغده العرقيه



ج ) 1. قارن باختصار بين كل مما يأتى :

أ‌- خاصيه التماسك وخاصيه التلاصق

ب‌- خيوط الأكتين وخيوط الميوسين

2. كيف تمكن العلماء من التعرف على وظائف الغدد الصماء ؟

——————————————————————————————–

السؤال الثانى

أ ) اكتب المفهوم العلمى لكل مما يأتى :

1. حلقات تتكون من التفاف جزىء DNA حول الهستونات داخل نواه الخليه
2. قدره البويضه على النمو بدون اخصاب من المشيج الذكرى فى الحيوان
3. جينات تحمل على كروموسومات مختلفه وتتوزع أثناء الانقسام الميوزى توزيعا مستقلا على الامشاج
4. موضع تقارب النهايات العصبيه لمحور خليه عصبيه والزوائد الشجيريه لخليه عصبيه لاحقه
5. عظمه صغيره مستديره تقع أمام مفصل الركبه
6. انتفاخ يشبه الفنجان يوجد فى مقدمه النفرون فى منطقه قشره الكليه

ب ) افحص الشكل المقابل ثم أجب عن الأسئله :

ما اسم هذا الجهاز ؟ وكيف يلائم وظيفه الحمل ؟
ما رقم واسم العضو الذى :

أ- لو تلف يؤدى الى استحاله استخدام تقنيه أطفال الأنابيب

ب- يسمح بالتمدد أثناء الولاده

جـ- يحدث به الاخصاب



ج ) 1. وضح بالرسم فقط تركيب :

الحيوان المنوى ؟ مبينا أهميه : الجسم القمى ؟

اذكر 4 استخدامات لتكنولوجيا DNA معاد الاتحاد فى الطب ؟

——————————————————————————–

السؤال الثالث

أ ) علل لما يأتى باختصار :

وجود غده دهنيه تحيط بالشعره قرب خروجها من جلد الانسان
يتخلف جزء من هواء الزفير داخل الرئتين باستمرار
لا تؤثر انزيمات القصر على DNA البكتيرى
ثبات نسبه السكر فى الدم عند 80 – 120 مجم / 100سم مكعب فى الشخص السليم



ب ) اذا كان تتابع النيوكليوتيدات على شريط DNA كالتالى :

5…ATGAAATCTCGCAAATGA…3

أنقل هذا الشريط ثم أكتب تتابع الشريط المكمل له لتكوين لولب مزدوج ؟
أكتب تتابع جزىء m-RNA المنسوخ من الشريط المكمل ؟
ما عدد الأحماض الامينيه المتكونه ؟ وما عدد انواع t-RNA المشاركه عند ترجمه هذا الشريط ؟

ج ) اشرح مع الرسم تجربه تثبت بها : أن الماء ينتقل خلال أوعيه الخشب فى جذر النبات ؟

السؤال الرابع

أ ) ماذا يحدث فى الحالات الآتيه باختصار :

1. وضع بادره نبات أفقيا لمده طويله
2. تعريض بيض ويرقات حشره الدروسوفيلا لدرجه حراره 25 م
3. مزج حمضين نووين من مصدرين مختلفين وتسخينهما 100 م ثم تبريدهما
4. لو أفرز الكبد انزيم الثرومبين مباشره



ب ) 1. ما المقصود بكل مما يأتى :

أ- اعاده الامتصاص الاختيارى

ب- الفسفره التأكسديه

جـ- الاندماج الثلاثى

2. اذكر الأسباب التى نلجأ فيها الى التلقيح الخلطى لزهره النبات ؟

ج ) رجل مصاب بالهيموفيليا وكانت أمه سليمه تزوج من امرأه سليمه وكان ابوها مريض بالهيموفليا

ما نسب الذكور والاناث المحتمل اصابتها فى أبنائهم ؟ فسر وراثيا ؟

————————————————————————————–

السؤال الخامس

أ ) انقل العبارات الآتيه بعد تصويب ما تحته خط :

يتم إعاده سائل الليمف الى الجهاز الدورى عن طريق الوريد البابى
فى التنفس الخلوى الهوائى يتم انتاج عدد 38 ATP داخل الميتوكوندريا
عند اندفاع ايونات الصوديوم داخل غشاء الليفه العصبيه يصبح فرق الجهد =

– 70 مللى فولت

تحدث التفاعلات الضوئيه للبناء الضوئى داخل الستروما فى البلاستيده الخضراء
يتم تثبيت ساق نبات البازلاء على الدعامه بواسطه حركه الجذور الشاده
المناسل المذكره فى نبات كثبره البئر هى الارشيجونيا
يتم افراز هرمون الاستروجين فى مرحله انضاج البويضه بواسطه الجسم الاصفر
تنشأ حاله القماءه نتيجه نقص هرمون الثيروكسين بعد البلوغ



ب ) 1. وضح بالرسم فقط والبيانات : تركيب الخليه العصبيه ؟

2. اكتب استخداما واحدا لكل مما يأتى :

أ- ماده الكولشيسين

ب- بكتيريا الكبريت الخضراء والارجوانيه

جـ- الخرائط الصبغيه



ج ) افحص الشكل المقابل الذى يوضح عمل الانزيم :

1. اذا كان B جزىء جلاكتوز فماذا يكون A و D و C
2. اذا كان D جزىء دهون فماذا يكون A و B و C
3. أى منهم الانزيم A – B – C – D ؟ مع التعليل ؟

———————————————————————————

السؤال السادس

أ ) اختر من الجدول [ ب ] ما يناسب الجدول [ أ ] ثم انقل العباره كامله :

[ أ ]


[ ب ]

1. مقابل الكودون
A. تتابع من النيوكليوتيدات على DNA يرتبط به انزيم بلمره RNA
2. كودون الوقف
B. تتابع من النيوكليوتيدات عند الطرف 3 لجزىء t-RNA
3. كودون البدء
C. تتابع من النيوكلوتيدات على m-RNA يرتبط بعامل الاطلاق
4. موقع الارتباط بالريبوسوم
D. يوجد عند الطرف 3 لجزىء m-RNA ليحميه من الانحلال
5. المحفز
E. تتابع من النيوكليوتيدات على t-RNA يتزاوج مع الكودونات
6. ذيل عديد الادينين
F. يوجد عند الطرف 5 على m-RNA ليجعل كودون البدء لأعلى











G. تتابع من النيوكليوتيدات على DNA يتم نسخه الى كودونات




H. تتابع من النيوكليوتيدات على m-RNA يمثل حمض الميثيونين



ب ) 1. وضح بالرسم فقط والبيانات : تركيب احدى فقرات العمود الفقرى للانسان ؟

2. اكتب نبذه مختصره عن كل مما يأتى :

أ- العقده الجيب أذينيه

ب- الغراء العصبى

جـ- تفاعل نقل الببتيديل

ج ) كيف يمكنك تفسير كل مما يأتى :

تختلف نواتج اختزال حمض البيروفيك باختلاف الكائن الحى الموجود به
قد يوجد ذكر به جسم بار وقد توجد أنثى ليس بها أى جسم بار
يختلف تأثير الجهاز العصبى الذاتى على الكبد وقت الراحه عن وقت الطوارىء

بسم الله الرحمن الرحيم

امتحان شامــل – أحيـــاء الثانــويه العامــه

مستوى B : اجب عن خمسه أسئله فقط الزمــن : 3 ساعــات

——————————————————————————————————

السؤال الأول ملحوظه : هذا الامتحان فى أربع صفحات

أ ) اختر الاجابه الصحيحه ثم انقلها فقط فى ورقه اجابتك :

من المغذيات الصغرى للنبات عنصر ……….

أ- الكبريت ب- الكربون جـ- الكلور د- الكالسيوم

أول حمض أمينى فى سلسله عديد الببتيد المتكونه عند تخليق البروتين ……….

أ- الميثيونين ب- الأرجينين جـ- الجلايسين د- الليسين

فصيله الدم AB تتمثل فيها حاله وراثيه تسمى ……….

أ- سياده تامه ب- انعدام سياده جـ- سياده غير تامه د- ارتباط تام

من الكائنات الحيه التى تتكاثر تكاثرا جنسيا ……….

أ- دوده البلاناريا ب- فطر الخميره جـ- فطر عفن الخبز د- طحلب الاسبيروجيرا

من بروتينات بلازما الدم والتى لها علاقه بعمليه تجلط الدم ……….

أ- الالبيومين ب- الجلوبيولين جـ- الفبرينوجين د- كل ما سبق

توجد مراكز الذاكره والنطق فى قشره المخ فى الفص ……….

أ- الجبهى ب- الجدارى جـ- الصدغى د- القفوى

ب ) 1. وضح بالرسم فقط والبيانات : أطوار بلازموديوم الملاريا التى تشاهدها فى عينه لدم المريض ؟

2. أكتب موضع ووظيفه كل مما يأتى :

أ- التجويف الأروح ب- الغده العرقيه

ج ) 1. قارن باختصار بين كل مما يأتى :

أ- خاصيه التماسك وخاصيه التلاصق ب- خيوط الأكتين وخيوط الميوسين

2. كيف تمكن العلماء من التعرف على وظائف الغدد الصماء ؟

السؤال الثانى

أ ) اكتب المفهوم العلمى لكل مما يأتى :

حلقات تتكون من التفاف جزىء DNA حول الهستونات داخل نواه الخليه

بقيه الاسئله فى صفحه – 2 -

- 2 -

————————————————————————————————-

قدره البويضه على النمو بدون اخصاب من المشيج الذكرى فى الحيوان
جينات تحمل على كروموسومات مختلفه وتتوزع أثناء الانقسام الميوزى توزيعا مستقلا على الامشاج
موضع تقارب النهايات العصبيه لمحور خليه عصبيه والزوائد الشجيريه لخليه عصبيه لاحقه
عظمه صغيره مستديره تقع أمام مفصل الركبه
انتفاخ يشبه الفنجان يوجد فى مقدمه النفرون فى منطقه قشره الكليه

ب ) افحص الشكل المقابل ثم أجب عن الأسئله :

ما اسم هذا الجهاز ؟ وكيف يلائم وظيفه الحمل ؟
ما رقم واسم العضو الذى :

أ- لو تلف يؤدى الى استحاله استخدام تقنيه أطفال الأنابيب

ب- يسمح بالتمدد أثناء الولاده جـ- يحدث به الاخصاب

ج ) 1. وضح بالرسم فقط تركيب : الحيوان المنوى ؟ مبينا أهميه : الجسم القمى ؟

2. اذكر 4 استخدامات لتكنولوجيا DNA معاد الاتحاد فى الطب ؟

السؤال الثالث

أ ) علل لما يأتى باختصار :

وجود غده دهنيه تحيط بالشعره قرب خروجها من جلد الانسان
يتخلف جزء من هواء الزفير داخل الرئتين باستمرار
لا تؤثر انزيمات القصر على DNA البكتيرى
ثبات نسبه السكر فى الدم عند 80 – 120 مجم / 100سم مكعب فى الشخص السليم

ب ) اذا كان تتابع النيوكليوتيدات على شريط DNA كالتالى :

5…ATGAAATCTCGCAAATGA…3

أنقل هذا الشريط ثم أكتب تتابع الشريط المكمل له لتكوين لولب مزدوج ؟
أكتب تتابع جزىء m-RNA المنسوخ من الشريط المكمل ؟
ما عدد الأحماض الامينيه المتكونه ؟ وما عدد انواع t-RNA المشاركه عند ترجمه هذا الشريط ؟

ج ) اشرح مع الرسم تجربه تثبت بها : أن الماء ينتقل خلال أوعيه الخشب فى جذر النبات ؟

بقيه الأسئله فى صفحه – 3 -

- 3 -

——————————————————————————————————

السؤال الرابع

أ ) ماذا يحدث فى الحالات الآتيه باختصار :

وضع بادره نبات أفقيا لمده طويله
تعريض بيض ويرقات حشره الدروسوفيلا لدرجه حراره25 م
مزج حمضين نووين من مصدرين مختلفين وتسخينهما100 مثم تبريدهما
لو أفرز الكبد انزيم الثرومبين مباشره

ب ) 1. ما المقصود بكل مما يأتى :

أ- اعاده الامتصاص الاختيارى ب- الفسفره التأكسديه جـ- الاندماج الثلاثى

2. اذكر الأسباب التى نلجأ فيها الى التلقيح الخلطى لزهره النبات ؟

ج ) رجل مصاب بالهيموفيليا وكانت أمه سليمه تزوج من امرأه سليمه وكان ابوها مريض بالهيموفليا

ما نسب الذكور والاناث المحتمل اصابتها فى أبنائهم ؟ فسر وراثيا ؟

السؤال الخامس

أ ) انقل العبارات الآتيه بعد تصويب ما تحته خط :

يتم إعاده سائل الليمف الى الجهاز الدورى عن طريق الوريد البابى
فى التنفس الخلوى الهوائى يتم انتاج عدد 38 ATP داخل الميتوكوندريا
عند اندفاع ايونات الصوديوم داخل غشاء الليفه العصبيه يصبح فرق الجهد =

– 70 مللى فولت

تحدث التفاعلات الضوئيه للبناء الضوئى داخل الستروما فى البلاستيده الخضراء
يتم تثبيت ساق نبات البازلاء على الدعامه بواسطه حركه الجذور الشاده
المناسل المذكره فى نبات كثبره البئر هى الارشيجونيا
يتم افراز هرمون الاستروجين فى مرحله انضاج البويضه بواسطه الجسم الاصفر
تنشأ حاله القماءه نتيجه نقص هرمون الثيروكسين بعد البلوغ

ب ) 1. وضح بالرسم فقط والبيانات : تركيب الخليه العصبيه ؟

2. اكتب استخداما واحدا لكل مما يأتى :

أ- ماده الكولشيسين ب- بكتيريا الكبريت الخضراء والارجوانيه جـ- الخرائط الصبغيه

بقيه الأسئله فى صفحه – 4 -

- 4 -

——————————————————————————————————

ج ) افحص الشكل المقابل الذى يوضح عمل الانزيم :

اذا كان B جزىء جلاكتوز فماذا يكون A و D و C
اذا كان D جزىء دهون فماذا يكون A و B و C
أى منهم الانزيم A – B – C – D ؟ مع التعليل ؟

السؤال السادس

أ ) اختر من الجدول [ ب ] ما يناسب الجدول [ أ ] ثم انقل العباره كامله :



[ أ ]


[ ب ]

1


مقابل الكودون


تتابع من النيوكليوتيدات على DNA يرتبط به انزيم بلمره RNA

2


كودون الوقف


تتابع من النيوكليوتيدات عند الطرف 3 لجزىء t-RNA

3


كودون البدء


تتابع من النيوكلوتيدات على m-RNA يرتبط بعامل الاطلاق

4


موقع الارتباط بالريبوسوم


يوجد عند الطرف 3 لجزىء m-RNA ليحميه من الانحلال

5


المحفز


تتابع من النيوكليوتيدات على t-RNA يتزاوج مع الكودونات

6


ذيل عديد الادينين


يوجد عند الطرف 5 على m-RNA ليجعل كودون البدء لأعلى



تتابع من النيوكليوتيدات على DNA يتم نسخه الى كودونات

تتابع من النيوكليوتيدات على m-RNA يمثل حمض الميثيونين

ب ) 1. وضح بالرسم فقط والبيانات : تركيب احدى فقرات العمود الفقرى للانسان ؟

2. اكتب نبذه مختصره عن كل مما يأتى :

أ- العقده الجيب أذينيه ب- الغراء العصبى جـ- تفاعل نقل الببتيديل

ج ) كيف يمكنك تفسير كل مما يأتى :

تختلف نواتج اختزال حمض البيروفيك باختلاف الكائن الحى الموجود به
قد يوجد ذكر به جسم بار وقد توجد أنثى ليس بها أى جسم بار
يختلف تأثير الجهاز العصبى الذاتى على الكبد وقت الراحه عن وقت الطوارىء

——————————————-

انتهت الأسئله مع تمنياتنا لكم بالتوفيق والتفوق

بسم الله الرحمن الرحيم

امتحان شامــل – أحيـــاء الثانــويه العامــه

مستوىA : اجب عن خمسه أسئله فقط الزمــن : 3 ساعــات

——————————————————————————————————

السؤال الأول ملحوظه : هذا الامتحان فى أربع صفحات

أ ) اختر الاجابه الصحيحه ثم انقلها فقط فى ورقه اجابتك :

العضو الذى يتم بداخله صنع ماده اليوريا هو ……….

أ- الكليتان ب- الكبد جـ- الرئتان د- الجلد

عندما تقوم خلايا العضلات بنشاط عنيف تتراكم بها نسبه عاليه من ……….

أ- حمض البيروفيك ب- حمض الستريك جـ- كحول ايثيلى د- حمض اللاكتيك

يدخل عنصر اليود فى تركيب هرمون ……….

أ- الباراثورمون ب- الكالسيتونين جـ- الثيروكسين د- الأدرينالين

يحدث الاخصاب للبويضه فى الانسان داخل ……….

أ- المبيض ب- قناه فالوب جـ- الرحم د- المهبل

ماده الميلين التى تغلف محاور الخلايا العصبيه عباره عن طبقه من ……….

أ- ماده دهنيه ب- ماده بروتينيه جـ- ماده نشويه د- كل ما سبق

تتصل الاحماض الامينيه ببعضها فى جزىء البروتين بواسطه روابط ……….

أ- هيدروجينيه ب- تساهميه جـ- أيونيه د- ببتيديه

وراثه عمى الالوان فى الانسان مثال لحاله ……….

أ- ارتباط جنسى ب- وراثه متأثره بالجنس جـ- سياده تامه د- سياده غير تامه

عند ملامسه الصفائح الدمويه لسطح خشن أو تعرضها للهواء يتحرر فى الدم ماده ……….

أ- الثرومبوبلاستين ب- الفبرينوجين جـ- البروثرومبين د- الثرومبين

ب ) 1. وضح بالرسم فقط والبيانات : ميكانيكيه حدوث عمليه الشهيق ؟

2. خاصيه الضغط الجذرى أثرها محدود فى صعود العصاره لقمم الاشجار – ناقش العباره باختصار ؟

ج ) قارن بين كل مما يأتى :

القوس الانعكاسى الارادى والقوس الانعكاسى اللاارادى .
الطفره الجسديه والطفره المشيجيه .

بقيه الأسئله فى صفحه – 2 -

- 2 -

——————————————————————————————————

السؤال الثانى

أ ) اكتب المفهوم العلمى فقط فى ورقه اجابتك :

أوعيه دقيقه مجهريه تصل بين التفرعات الشريانيه الدقيقه والتفرعات الوريديه الدقيقه
ربط وقطع قناتى فالوب أو الوعائين الناقلين كوسيله لمنع الحمل
جينات لو وجدت بصوره نقيه أو متماثله تسبب تعطيل النمو لربع النسل غالبا
أول مركب عضوى ثابت كيميائيا ينتج من عمليه البناء الضوئى
جزيئات DNA الصغيره الدائريه الموجوده فى أوليات النواه ولها دور فى الهندسه الوراثيه
عظمه ظهريه مفلطحه ومثلثه الشكل توجد فى الحزام الصدرى

ب ) 1. أكتب موضع ووظيفه كل مما يأتى :

أ- غده البروستاتا ب- جزر لانجرهانز

2. وضح بالرسم فقط والبيانات : مرحله نضج البويضه فى الانسان ؟

ج ) افحص الشكل المقابل ثم أجب عن الأسئله :

ما الايونات التى يمثلها رقم 3 ؟ وما دورها فى التشابك العصبى ؟
ما اسم الماده رقم 6 ؟ وما مصيرها بعد انتهاء عملها ؟
ما اسم رقم 4 و رقم 7 ؟ وماذا يحدث لرقم 7 عند اثارته ؟
ما اتجاه السهم الصحيح 1 أم 2 ؟ مع التفسير ؟

السؤال الثالث

أ ) علل لما يأتى باختصار :

وجود تحززات كثيره فى بطانه الامعاء الغليظه
ندره حدوث التضاعف الصبغى فى الحيوان
يمكن نقل t-RNA بين الكائنات الحيه بأمان ولا يمكن نقل m-RNA بنفس الأمان
لا توجد ذكور حامله لمرض الهيموفليا و مرض الصلع المبكر
يسمع الطبيب صوتين مختلفين لضربات القلب بالسماعه

ب ) 1. ما المقصود بكل مما يأتى :

أ- زراعه الأنسجه ب- الجينات المتكامله

بقيه الأسئله فى صفحه – 3 -

- 3 -

——————————————————————————————————

بقيه السؤال الثالث :

2. مميتكون العصير المعدى ؟ وما دوره فى الهضم ؟

ج ) ارسم الجهاز المستخدم فى تجربه لاثبات أن النبات الأخضر يتنفس ؟ اذكر المشاهده والاستنتاج ؟

السؤال الرابع :

أ ) انقل العبارات الآتيه فى ورقه اجابتك مع تصويب ما تحته خط :

ينتج فى التنفس الخلوى الهوائى داخل الميتوكوندريا عدد 38 ATP
عند زياده هرمون النمو عن نسبته الطبيعيه بعد البلوغ تنشأ حاله القزامه
عندما يصعب تمييز المحيطين الخارجيين لزهره يسمى المحيطان معا بالنوره
تبدأ الدوره الرئويه الصغرى من الأذين الايمن وتنتهى فى الاذين الايسر
النسب الانعزاليه فى حاله انعدام السياده 3 : 1
عند التقاء عظمتى الحرقفه بالورك يوجد التجويف الاروح لتتصل بع رأس عظمه الفخذ
يتم اتصال سيتوبلازم الانابيب الغرباليه بعضها ببعض عن طريق الخلايا المرافقه
العالم الذى أكتشف وجود صمامات الأورده هو العالم مالبيجى

ب ) اذا كان ترتيب القواعد فى أحد شريطى الجين كالتالى :

TACAGGTTACCCGGGAGATTAATT … …

أكتب شريط m-RNA المنسوخ من الشريط السابق ؟

وحدد عليه الطرف 5 والطرف 3 ؟ مع التعليل ؟

اذا كان التتابع الذى تحته خط موقع تعرف انزيم القصر ويتم القطع بين CG فهل من الممكن استخدام انزيم القصر هذا فى استنتاخ تتابعات DNA ؟ مع التفسير ؟

ج ) اعطيت فقط زجاجتين بهما سلالتين لبذور نبات ما كلاهما أخضر اللون ( علما بأن اللون الاخضر سائد )

كيف تميز أى من الزجاجتين بها بذور نقيه وأى منهم بها بذور هجين ؟ فسر وراثيا ؟

السؤال الخامس :

أ ) ماذا يحدث فى الحالات الأتيه باختصار :

اصابه النخاع المستطيل اصابه بالغه الشده
توقف الكبد عن افراز ماده الهيبارين

بقيه الأسئله فى صفحه – 4 -

- 4 –

——————————————————————————————————

دخول ايونات الصوديوم بكميه كبيره داخل الليفه العصبيه
تحرر الميروزيتات فى دم مريض مصاب ببلازموديوم الملاريا
اختفاء انزيم اللولب من خلايا عظام أحد الاطفال
تعريض بويضات الضفدعه لصدمه حراريه

ب ) 1. ما المقصود بالقطعه العضليه ؟ هل حجمها يتغير عند الانقباض ؟ مع التفسير ؟

2. وضح بالرسم فقط والبيانات : تركيب البلاستيده الخضراء ؟

ج ) 1. ما المقصود بالمحتوى الجينى ؟ اكتب نبذه مختصره عنه ؟

2. ما الوحده الوظيفيه لكل مما يأتى :

أ- الكليتين ب- جزىء DNA جـ- الرئتين د- الجلد

السؤال السادس

أ ) اختر من الجدول ( ب ) ما يناسب الجدول ( أ ) ثم انقل العباره كامله :



( أ )


( ب )

1


غشاء المساريقا


تحيط بالمخ والنخاع الشوكى

2


غشاء التامور


يحيط باليطن من الداخل

3


غشاء الرهل


يحيط بالجنين وتخرج منه زوائد اصبعيه لتكوين المشيمه

4


الاغشيه السحائيه


يحيط بالجنين وتلتحم نهايتاه لتكوين الحبل السرى



يربط التواءات اللفائفى ببعضها

يحيط بالقلب لحمايته وتسهيل حركته

ب ) فسر كل مما يأتى باختصار :

لا تنتقل المواد الضروريه من دم الانسان الى سائل جهاز الكلى الصناعى
يعتبر نبات كثبره البئر من الأمثله النموذجيه للتكائر بتبادل الأجيال
يزيد عدد مرات التبول لمريض السكر خاصه فى المساء عند النوم
اختيار طحلب النيتيلا بالذات لتجربه اثبات حدوث النقل النشط

ج ) 1. فى الشكل المقابل أى منهم موضع الطرف 3 لجزىء t-RNA

[ 1 أم 2] مع التفسير ؟

2. اكتب نبذه مختصره عن كل مما يأتى :

أ- الثقب الكبير ب- الثمره الكاذبه جـ- البروتينات التركيبيه

انتهت الأسئله

بسم الله الرحمن الرحيم

امتحان شامــل – أحيـــاء الثانــويه العامــه

——————————————————————————————————

السؤال الأول ملحوظه : هذا الامتحان فى أربع صفحات

أ ) اختر الاجابه الصحيحه ثم انقلها فقط فى ورقه اجابتك :

الكودون عباره عن ثلاثه نيوكليوتيدات على جزىء ……….

أ- DNA ب- m-RNA جـ- t-RNA د- r-RNA

العصاره التى لا تحتوى على أى انزيمات هاضمه هى العصاره ……….

أ- المعديه ب- البنكرياسيه جـ- الصفراويه د- المعويه

الدم الذى يغادر القلب ويعمل على تغذيه خلايا المخ يترك القلب من ……….

أ- البطين الأيسر ب- البطين الأيمن جـ- الأذين الأيسر د- الأذين الأيمن

الجزء المسئول عن تنقيه دم الانسان من الفضلات النيتروجينيه كاليوريا هو ……….

أ- الحالبان ب- المثانه البوليه جـ – مجرى البول د- النفرون

يمر الماء عبر جدران الخلايا والمسافات البينيه للنبات بخاصيه ……….

أ- الاسموذيه ب- التشرب جـ- النقل النشط د- النفاذيه الاختياريه

استطاع مندل فى تجاربه التوصل الى السياده التامه عن طريق تلقيح ……….

أ- ذاتى ب- خلطى جـ- ذاتى ثم خلطى د- خلطى ثم ذاتى

ب ) 1. وضح بالرسم فقط والبيانات : كيفيه تنقيه دم مريض الفشل الكلوى بجهاز الكلى الصناعى ؟

2. ما المقصود بتهجين الحمض النووى ؟ وكيف يستخدم لمعرفه وجود جين معين فى محتواه الجينى ؟

ج ) قارن باختصار بين كل مما يأتى :

1. التغر المائى والثغر الهوائى 2. عظام الرسغ وعظام العرقوب 3. الصلع المبكر فى الذكر والأنثى

السؤال الثانى

أ ) اكتب المفهوم العلمى فقط فى ورقه اجابتك :

عمليه تكوين ATP من ADP والفوسفات فى الغشاء الداخلى للميتوكوندريا فى المرحله الاخيره من مراحل التنفس الخلوى الهوائى
تشبه أوعيه خشب الساق وتظهر فى القطاع العرضى بشكل خماسى او سداسى ومسحوبه الطرف

بقيه الأسئله فى صفحه – 2 -

- 2 -

——————————————————————————————————

عظمه فى القفص الصدرى مفلطحه ومدببه من أسفل وجزؤها السفلى غضروفى
تبادل بين أجزاء الكروماتيدات الداخليه للكروموسومات المتماثله يحدث اثناء الانقسام الميوزى
الفتره التى لا تستجيب فيها الخليه العصبيه لأى مؤثر مهما كانت قوته حتى تستعيد خواصها الفسيولوجيه
قدره بعض الكائنات على التكاثر بطريقتين حيث يتعاقب فى دورة حياتها جيل يتكاثر جنسيا مع جيل أو أكثر يتكاثر لا جنسيا

ب ) 1. وضح بالرسم فقط والبيانات : قطاع فى مبيض نبات ناضج ؟

2. اكتب موضع ووظيفه كل مما يأتى :

أ- العقده الجيب أذينيه ب- مقابل الكودون جـ- شريط كاسبرى

ج ) افحص الشكل المقابل عن مراحل السيال العصبى ثم أجب عن الأسئله التاليه :

ماذا يسمى المنحنى A مع المنحنى B مجتمعين ؟
ما الايونات التى تدخل الخليه فى الفتره A ؟ وبم تسمى هذه الفتره ؟
ما الايونات التى تغادر الى خارج الخليه فى الفتره B ؟ وبم تسمى ؟
علل : عدم حدوث سيال عصبى للأثاره العصبيه C ؟

السؤال الثالث

أ ) علل لما يأتى باختصار :

لا يحدث اجهاض للجنين لو تحلل الجسم الأصفر بعد نهايه الشهر الثالث للحمل
تعتبر الحويصلات الهوائيه أسطح تنفسيه فعليه
صغر حجم حبيبات النشا داخل الستروما فى البلاستيدات الخضراء
فصائل دم الانسان مثال لثلاث حالات وراثيه مختلفه
تلتف جزيئات DNA حول الهستونات فى حقيقيات النواه

ب) 1. أب و أم فصيله دمهما مختلفه انجبا جميع ابنائهم من فصيله دم واحده ؟ فسر على أسس وراثيه ؟

2. ما تأثير الجهاز العصبى الذاتى على كل مما يأتى :

أ- القصبه الهوائيه ب- الغدد اللعابيه

ج ) اشرح مع الرسم تجربه توضح : بها عمليه التخمر الكحولى فى الخميره ؟

مع ذكر الاحتياطات الازمه لاجراء التجربه ؟

بقيه الأسئله فى صفحه – 3 –



- 3 -

——————————————————————————————————

السؤال الرابع

أ ) ماذا يحدث فى الحالات الآتيه باختصار :

زياده افراز هرمون الباراثورمون
عدم نزول الخصيتان من تجويف البطن الى كيس الصفن
توقف الكليتان معا عن العمل فى نفس الوقت
ادخال جينات البقوليات المستضيفه لبكتيريا تثبيت النيتروجين الى محصول آخر
استئصال البنكرياس تجريبيا من بطن حيوان ثدى
وجود كودون وقف فى موقع الامينوأسيل للريبوسوم أثناء عمليه ترجمه البروتين

ب ) 1. اذكر 4 استخدامات للجينوم البشرى ؟

2. وضح بالرسم فقط والبيانات : قطاع طولى فى لحاء نبات ذو فلقتين ؟

ج ) اذا كان ترتيب القواعد النيتروجينيه فى شريط DNA كالتالى :

TACGCGCTTATAATC

احسب نسبه الادينين فى قطعه لولب DNA المزدوج اذا كان الشريط السابق أحد اشرطه هذا اللولب ؟
حدثت طفره استبدال النيوكليوتيده G ولم يتغير نوع الاحماض الامينيه المتكونه من هذا الشريط – فسر ذلك ؟ مع ذكر نوع هذه الطفره ؟

السؤال الخامس

أ ) انقل العبارات الآتيه مع تصويب ما تحته خط :

تحدث الوفاه مباشره عند اصابه الفص الجدارى لقشره الدماغ اصابه بالغه الشده
سائل الليمف يحتوى على كل مكونات البلازما بالاضافه لعدد كبير من الصفائح الدمويه
يتم افراز اللبن للرضاعه عن طريق هرمون الريلاكسين الذى تفرزه الغده النخاميه
فى دوره كربس الواحده يتم اختزال عدد 3 جزيئات من مساعد الانزيم CO-A
المسافه بين كل خطين داكنين فى الليفه العضليه تسمى القطعه الداكنه
الهيموفيليا من الامراض التى تنتمى لحاله الوراثيه تعرف بالجينات المميته
فى نهايه اليوم السابع للاخصاب يتم زرع البويضه فى بطانه الرحم

بقيه الأسئله فى صفحه – 4 -

- 4 -

——————————————————————————————————

ب ) 1. اذكر الشروط الواجب توافرها لصعود الماء فى أوعيه الخشب بشد النتح ؟

2. اكتب طرق تخلص النبات من ثانى أكسيد الكربون ؟

ج ) افحص الشكل المقابل ثم أجب عن الأسئله :

ما اسم هذا الشكل ؟
ما العمليه التى يبدأ فيها تكون الأنبوبه A ؟ وماذا يحدث للنواه C ؟
ما وظيفه النواتين B ؟

السؤال السادس

أ ) اختر من الجدول ( ب ) ما يناسب الجدول ( أ ) ثم انقل العبارات كامله :



( أ )


( ب )

1


انزيم اللولب


ينسخ m-RNA من DNA

2


انزيم هيالويورينيز


يوجد فى الفيروسات التى محتواها الجينى RNA

3


انزيم المالتيز


يكسر الروابط الهيدروجينيه فى جزىء DNA

4


انزيم كولين استريز


ينشط انزيم التربسينوجين ويحوله الى تربسين نشط

5


انزيم النسخ العكسى


يحلل DNA تحليلا كاملا

6


انزيم انتروكينيز


يعمل على اذابه جزء من غلاف البويضه لحدوث الاخصاب



يتوافر فى نقاط الاتصال العصبى العضلى

يتم افرازه من الفم والبنكرياس لتكوين سكر الشعير

ب ) كيف يمكنك تفسير كل مما يأتى :

وجود زيل من عديد الأدينين فى جزىء m-RNA
حدوث تفاعلات سلسله نقل الالكترون فى التنفس الخلوى الهوائى داخل الميتوكوندريا ؟

ج ) 1. قارن بالرسم فقط والبيانات : بين مرحله نضج البويضه ومرحله نضج الحيوان المنوى فى الانسان ؟

2. أكتب نبذه مختصره عن كل مما يأتى :

أ- مكونات القوس الانعكاسى ب- التعقيم الجراحى جـ- الضلوع العائمه

انتهت الأسئله==========
الرجوع الى أعلى الصفحة اذهب الى الأسفل
معاينة صفحة البيانات الشخصي للعضو http://ashrafgaper.forumegypt.net
 
مراجعة اسئلة مادة الاحياء , التوقعات المرئية 2012
الرجوع الى أعلى الصفحة 
صفحة 1 من اصل 1

صلاحيات هذا المنتدى:لاتستطيع الرد على المواضيع في هذا المنتدى
مهندس اشرف جابر فتح الله :: المنتديات :: المنتدى التعليمى والجامعات والمدارس :: المرحلة الابتدائية :: الصف السادس :: الترم الاول :: الصف الثالث-
انتقل الى: